The detailed information of tRNA gene sequence


Sequence ID>C161050459
Genome IDCP013062
Search identical group
Phylum/ClassCandidatus Peregrinibacteria
SpeciesCandidatus Peribacter riflensis isolate RIFOXYA2_FULL_PER-ii_58_14
Start position on genome 609093
End posion on genome 609017
Amino Acid Pro
Anticodon GGG
Upstream region at tRNA start position
gtttgcgcgt
tRNA gene sequence
CGGGGCGTAGTTCAGTTGGCTAGAACGCTTGCATGGGGTGCAAGAGGTCGCAGGTTCAAG
TCCTGTCGCCCCGACCA
Downstream region at tRNA end position
aagactgcaa
Secondary structure (Cloverleaf model)
>C161050459	Pro	GGG
                   t      ACCA aagactgcaa
                     C - G
                     G - C
                     G - C
                     G - C
                     G - C
                     C - G
                     G - C          T G
                    T     T G T C C     A
      T G A        A      + | | | |     A
    T       C T T G       G C A G G     C
    G       | | | |                 T T
    G       G A A C
      C T A        G     AGGTC
                    C - G
                    T - A
                    T - A
                    G - C
                    C - G
                  A       T
                  T       G
                    G G G
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK