The detailed information of tRNA gene sequence


Sequence ID>C161050476
Genome IDCP013063
Search identical group
Phylum/ClassCandidatus Peregrinibacteria
SpeciesCandidatus Peribacter riflensis isolate RIFOXYB2_FULL_PER-ii_58_17
Start position on genome 423655
End posion on genome 423730
Amino Acid Phe
Anticodon GAA
Upstream region at tRNA start position
cgagcgccgt
tRNA gene sequence
GGCCCGGTAGCTCAGTTGGTAGAGCACTCGCCTGAAGAGCGAGGTGTCACCAGTTCGATC
CTGGTCTGGGCCACCA
Downstream region at tRNA end position
ttcgactcgt
Secondary structure (Cloverleaf model)
>C161050476	Phe	GAA
                   t      ACCA ttcgactcgt
                     G - C
                     G - C
                     C - G
                     C - G
                     C - G
                     G + T
                     G - C          C T
                    T     T G G T C     A
      T G A        A      | | | | |     G
    T       C T C G       A C C A G     C
    G       | | | |                 T T
    G       G A G C
      T A          A     GTGTC
                    C - G
                    T - A
                    C - G
                    G - C
                    C - G
                  C       A
                  T       G
                    G A A
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK