The detailed information of tRNA gene sequence


Sequence ID>C161050477
Genome IDCP013063
Search identical group
Phylum/ClassCandidatus Peregrinibacteria
SpeciesCandidatus Peribacter riflensis isolate RIFOXYB2_FULL_PER-ii_58_17
Start position on genome 433413
End posion on genome 433489
Amino Acid Ile
Anticodon TAT
Upstream region at tRNA start position
ctttcaccgt
tRNA gene sequence
GGGCGAGTAGCTCAGTCGGTTAGAGCACGGGACTTATAAGCCCGCGGTCGGTGGTTCAAA
TCCACCCTCGCCCACCA
Downstream region at tRNA end position
accttcgctc
Secondary structure (Cloverleaf model)
>C161050477	Ile	TAT
                   t      ACCA accttcgctc
                     G - C
                     G - C
                     G - C
                     C - G
                     G - C
                     A - T
                     G - C          T A
                    T     C C A C C     A
      T G A        A      | | | | |     A
    C       C T C G       G G T G G     C
    G       | | | |                 T T
    G       G A G C
      T T A        A     CGGTC
                    C - G
                    G - C
                    G - C
                    G - C
                    A   G
                  C       A
                  T       A
                    T A T
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK