The detailed information of tRNA gene sequence


Sequence ID>C161050481
Genome IDCP013063
Search identical group
Phylum/ClassCandidatus Peregrinibacteria
SpeciesCandidatus Peribacter riflensis isolate RIFOXYB2_FULL_PER-ii_58_17
Start position on genome 648750
End posion on genome 648835
Amino Acid Leu
Anticodon CAA
Upstream region at tRNA start position
ataaggatgt
tRNA gene sequence
GCCGGAGTGGCGGAATTGGTAGACGCGCACGACTCAAAATCGTGTGCCGCAAGGCGTTGA
GGGTTCGATTCCCTCCTCCGGCACCA
Downstream region at tRNA end position
ttcgtcggcc
Secondary structure (Cloverleaf model)
>C161050481	Leu	CAA
                   t      ACCA ttcgtcggcc
                     G - C
                     C - G
                     C - G
                     G - C
                     G - C
                     A - T
                     G - C          T T
                    T     C T C C C     A
      T A A        G      | | | | |     G
    T       G G C G       G A G G G     C
    G         | | |                 T T
    G       A C G C
      T A G        G     TGCCGCAAGGCGTT
                    C - G
                    A - T
                    C - G
                    G - C
                    A - T
                  C       A
                  T       A
                    C A A
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK