The detailed information of tRNA gene sequence


Sequence ID>C161050482
Genome IDCP013063
Search identical group
Phylum/ClassCandidatus Peregrinibacteria
SpeciesCandidatus Peribacter riflensis isolate RIFOXYB2_FULL_PER-ii_58_17
Start position on genome 654915
End posion on genome 654990
Amino Acid Met
Anticodon CAT
Upstream region at tRNA start position
ctaccactgt
tRNA gene sequence
GTCACGGTAGCTCAGTTGGTAGAGCACAGGACTCATAAGCCTGGGGTCGCCGGTTCAATC
CCGGCCCGTGACACCA
Downstream region at tRNA end position
gccttcgctc
Secondary structure (Cloverleaf model)
>C161050482	Met	CAT
                   t      ACCA gccttcgctc
                     G - C
                     T - A
                     C - G
                     A - T
                     C - G
                     G - C
                     G - C          C T
                    T     C G G C C     A
      T G A        A      | | | | |     A
    T       C T C G       G C C G G     C
    G       | | | |                 T T
    G       G A G C
      T A          A     GGGTC
                    C - G
                    A - T
                    G - C
                    G - C
                    A   G
                  C       A
                  T       A
                    C A T
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK