The detailed information of tRNA gene sequence


Sequence ID>C161050496
Genome IDCP013063
Search identical group
Phylum/ClassCandidatus Peregrinibacteria
SpeciesCandidatus Peribacter riflensis isolate RIFOXYB2_FULL_PER-ii_58_17
Start position on genome 858276
End posion on genome 858202
Amino Acid Glu
Anticodon CTC
Upstream region at tRNA start position
cgttcttttt
tRNA gene sequence
GGCCCCATCGTCTAACGGTTAGGACACTTGGTTCTCATCCAGGAAATCGGGGTTCGATTC
CCCGTGGGGCTACCA
Downstream region at tRNA end position
acatgagcgc
Secondary structure (Cloverleaf model)
>C161050496	Glu	CTC
                   t      ACCA acatgagcgc
                     G + T
                     G - C
                     C - G
                     C - G
                     C - G
                     C - G
                     A - T          T T
                    T     G C C C C     A
      C A A        C      | | | | |     G
    G       T C T G       C G G G G     C
    G       + | | |                 T T
    T       G G A C
      T A          A     AAAT
                    C - G
                    T + G
                    T - A
                    G - C
                    G - C
                  T       T
                  T       A
                    C T C
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK