The detailed information of tRNA gene sequence


Sequence ID>C161050498
Genome IDCP013063
Search identical group
Phylum/ClassCandidatus Peregrinibacteria
SpeciesCandidatus Peribacter riflensis isolate RIFOXYB2_FULL_PER-ii_58_17
Start position on genome 675733
End posion on genome 675657
Amino Acid Arg
Anticodon CCG
Upstream region at tRNA start position
tggccgccgt
tRNA gene sequence
GCGCCCGTAGCTCAACTGGATAGAGCGTCAGCCTCCGAAGCTGAAGGCTGTGGGTTCAAA
TCCCGCCGGGCGCACCA
Downstream region at tRNA end position
tactatttct
Secondary structure (Cloverleaf model)
>C161050498	Arg	CCG
                   t      ACCA tactatttct
                     G - C
                     C - G
                     G - C
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     C G C C C     A
      C A A        A      | + | | |     A
    T       C T C G       G T G G G     C
    G       | | | |                 T T
    G       G A G C
      A T A        G     AGGCT
                    T - A
                    C - G
                    A - T
                    G - C
                    C - G
                  C       A
                  T       A
                    C C G
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK