The detailed information of tRNA gene sequence


Sequence ID>C161050506
Genome IDCP013063
Search identical group
Phylum/ClassCandidatus Peregrinibacteria
SpeciesCandidatus Peribacter riflensis isolate RIFOXYB2_FULL_PER-ii_58_17
Start position on genome 538812
End posion on genome 538737
Amino Acid Arg
Anticodon TCT
Upstream region at tRNA start position
tctctcttgt
tRNA gene sequence
GCCCCCGTAGCTCAGTGGATAGAGCAGCAGGTTTCTAACCTGTTGGCCGTAGGTTCAATT
CCTACCGGGGGTACCA
Downstream region at tRNA end position
ctttttctgt
Secondary structure (Cloverleaf model)
>C161050506	Arg	TCT
                   t      ACCA ctttttctgt
                     G + T
                     C - G
                     C - G
                     C - G
                     C - G
                     C - G
                     G - C          T T
                    T     C A T C C     A
      T G A        A      | | | | |     A
    G       C T C G       G T A G G     C
    G       | | | |                 T T
    A       G A G C
      T A          A     TGGCC
                    G + T
                    C - G
                    A - T
                    G - C
                    G - C
                  T       A
                  T       A
                    T C T
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK