The detailed information of tRNA gene sequence


Sequence ID>C161050507
Genome IDCP013063
Search identical group
Phylum/ClassCandidatus Peregrinibacteria
SpeciesCandidatus Peribacter riflensis isolate RIFOXYB2_FULL_PER-ii_58_17
Start position on genome 506184
End posion on genome 506110
Amino Acid Gln
Anticodon TTG
Upstream region at tRNA start position
gtcatcacgt
tRNA gene sequence
TGGGGAGTCGCCAAGTGGTAAGGCAGCGGCCTTTGAAGCCGCCATTCGAAGGTTCGAATC
CTTCCTCCCCAGCCA
Downstream region at tRNA end position
tgaaccagag
Secondary structure (Cloverleaf model)
>C161050507	Gln	TTG
                   t      GCCA tgaaccagag
                     T - A
                     G - C
                     G - C
                     G - C
                     G - C
                     A - T
                     G - C          T A
                    T     C T T C C     A
        G A        C      | | | | |     G
      T     A C C G       G A A G G     C
      G       | | |                 T T
      G     A G G C
        T A        A     CATTC
                    G - C
                    C - G
                    G - C
                    G - C
                    C - G
                  C       A
                  T       A
                    T T G
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK