The detailed information of tRNA gene sequence


Sequence ID>C161050510
Genome IDCP013063
Search identical group
Phylum/ClassCandidatus Peregrinibacteria
SpeciesCandidatus Peribacter riflensis isolate RIFOXYB2_FULL_PER-ii_58_17
Start position on genome 362976
End posion on genome 362891
Amino Acid Tyr
Anticodon GTA
Upstream region at tRNA start position
tgctattcgt
tRNA gene sequence
GGGTCGGTACCGAAGTGGTCAAACGGGCCTGACTGTAAATCAGGTGGCTTACGCCTTCGG
GGGTTCGAGTCCCTCCCGGCCCACCA
Downstream region at tRNA end position
tcctccgcgc
Secondary structure (Cloverleaf model)
>C161050510	Tyr	GTA
                   t      ACCA tcctccgcgc
                     G - C
                     G - C
                     G - C
                     T + G
                     C - G
                     G - C
                     G - C          T G
                    T     C T C C C     A
      T G A        A      | + | | |     G
    G       A G C C       G G G G G     C
    G         | | |                 T T
    T       A C G G
      C A A        G     TGGCTTACGCCTTC
                    C - G
                    C - G
                    T - A
                    G - C
                    A - T
                  C       A
                  T       A
                    G T A
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK