The detailed information of tRNA gene sequence


Sequence ID>C161050512
Genome IDCP013063
Search identical group
Phylum/ClassCandidatus Peregrinibacteria
SpeciesCandidatus Peribacter riflensis isolate RIFOXYB2_FULL_PER-ii_58_17
Start position on genome 167533
End posion on genome 167459
Amino Acid Gln
Anticodon CTG
Upstream region at tRNA start position
cgtttcacgt
tRNA gene sequence
TGGGGAGTCGCCAAGTGGTAAGGCACCTGCCTCTGGAGCAGGCATTCGGGGGTTCGAATC
CCTCCTCCCCAGCCA
Downstream region at tRNA end position
tccggcttcg
Secondary structure (Cloverleaf model)
>C161050512	Gln	CTG
                   t      GCCA tccggcttcg
                     T - A
                     G - C
                     G - C
                     G - C
                     G - C
                     A - T
                     G - C          T A
                    T     C T C C C     A
        G A        C      | + | | |     G
      T     A C C G       G G G G G     C
      G       | | |                 T T
      G     A G G C
        T A        A     CATTC
                    C - G
                    C - G
                    T - A
                    G - C
                    C - G
                  C       A
                  T       G
                    C T G
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK