The detailed information of tRNA gene sequence


Sequence ID>C161050514
Genome IDCP013063
Search identical group
Phylum/ClassCandidatus Peregrinibacteria
SpeciesCandidatus Peribacter riflensis isolate RIFOXYB2_FULL_PER-ii_58_17
Start position on genome 53256
End posion on genome 53168
Amino Acid Leu
Anticodon GAG
Upstream region at tRNA start position
gcggttgcct
tRNA gene sequence
GCCGTGGTGGCGGAACTGGTAGACGCGCTAGCTTGAGGGGCTAGTGTCCGTTCTAGGACA
TGGGAGTTCGAGTCTCCCCCACGGCACCA
Downstream region at tRNA end position
ttctcactcg
Secondary structure (Cloverleaf model)
>C161050514	Leu	GAG
                   t      ACCA ttctcactcg
                     G - C
                     C - G
                     C - G
                     G - C
                     T - A
                     G - C
                     G - C          T G
                    T     C C C T C     A
      C A A        G      | | | | |     G
    T       G G C G       G G G A G     C
    G         | | |                 T T
    G       A C G C
      T A G        G     TGTCCGTTCTAGGACAT
                    C - G
                    T - A
                    A - T
                    G - C
                    C - G
                  T       G
                  T       G
                    G A G
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK