| Sequence ID | >C161050515 |
| Genome ID | CP013064 |
| Phylum/Class | Unclassified |
| Species | Candidatus Peribacter riflensis [CP013064] |
| Start position on genome | 25121 |
| End posion on genome | 25196 |
| Amino Acid | Thr |
| Anticodon | CGT |
| Upstream region at tRNA start position |
tacgtccacc |
| tRNA gene sequence |
GCCGCTGTAGCTCAGCTGGTAGAGCAACGGTATCGTAAACCGTGGGTCACCGGTTCAAAT |
| Downstream region at tRNA end position |
ctcttctccg |
| Secondary structure (Cloverleaf model) | >C161050515 Thr CGT
c TCCA ctcttctccg
G - C
C - G
C - G
G - C
C - G
T - A
G - C T A
T T G G C C A
C G A A | | | | | A
T C T C G A C C G G C
G | | | | T T
G G A G C
T A A GGGTC
A - T
C - G
G - C
G - C
T - A
A A
T A
C G T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | - |
| Comment | |
| --- | |
| Input Comment |