The detailed information of tRNA gene sequence


Sequence ID>C161050515
Genome IDCP013064
Search identical group
Phylum/ClassCandidatus Peregrinibacteria
SpeciesCandidatus Peribacter riflensis isolate RIFOXYC2_FULL_PER-ii_58_32
Start position on genome 25121
End posion on genome 25196
Amino Acid Thr
Anticodon CGT
Upstream region at tRNA start position
tacgtccacc
tRNA gene sequence
GCCGCTGTAGCTCAGCTGGTAGAGCAACGGTATCGTAAACCGTGGGTCACCGGTTCAAAT
CCGGTCAGCGGCTCCA
Downstream region at tRNA end position
ctcttctccg
Secondary structure (Cloverleaf model)
>C161050515	Thr	CGT
                   c      TCCA ctcttctccg
                     G - C
                     C - G
                     C - G
                     G - C
                     C - G
                     T - A
                     G - C          T A
                    T     T G G C C     A
      C G A        A      | | | | |     A
    T       C T C G       A C C G G     C
    G       | | | |                 T T
    G       G A G C
      T A          A     GGGTC
                    A - T
                    C - G
                    G - C
                    G - C
                    T - A
                  A       A
                  T       A
                    C G T
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK