The detailed information of tRNA gene sequence


Sequence ID>C161050535
Genome IDCP013064
Search identical group
Phylum/ClassCandidatus Peregrinibacteria
SpeciesCandidatus Peribacter riflensis isolate RIFOXYC2_FULL_PER-ii_58_32
Start position on genome 1067044
End posion on genome 1067132
Amino Acid Leu
Anticodon TAG
Upstream region at tRNA start position
catgcctcgt
tRNA gene sequence
GCCGAGGTGGCGGAATTGGTAGACGCGCCAGCCTTAGGAGCTGGTCCCGCGCAAGCGGGA
TAGAGGTTCGAGCCCTCTCCTCGGCACCA
Downstream region at tRNA end position
gcaaataggc
Secondary structure (Cloverleaf model)
>C161050535	Leu	TAG
                   t      ACCA gcaaataggc
                     G - C
                     C - G
                     C - G
                     G - C
                     A - T
                     G - C
                     G - C          C G
                    T     T C T C C     A
      T A A        G      | | | | |     G
    T       G G C G       A G A G G     C
    G         | | |                 T T
    G       A C G C
      T A G        G     TCCCGCGCAAGCGGGAT
                    C - G
                    C - G
                    A - T
                    G - C
                    C - G
                  C       A
                  T       G
                    T A G
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK