The detailed information of tRNA gene sequence


Sequence ID>C161050536
Genome IDCP013064
Search identical group
Phylum/ClassCandidatus Peregrinibacteria
SpeciesCandidatus Peribacter riflensis isolate RIFOXYC2_FULL_PER-ii_58_32
Start position on genome 1109810
End posion on genome 1109884
Amino Acid Thr
Anticodon TGT
Upstream region at tRNA start position
tcatgcctag
tRNA gene sequence
GCCGCTTTAGCTCAGTGGTAGAGCAACTCACTTGTAATGAGTAGGTCCGGGGTTCAAATC
CCCGAAGCGGCTCCA
Downstream region at tRNA end position
tccggctcca
Secondary structure (Cloverleaf model)
>C161050536	Thr	TGT
                   g      TCCA tccggctcca
                     G - C
                     C - G
                     C - G
                     G - C
                     C - G
                     T - A
                     T - A          T A
                    T     G C C C C     A
        G A        A      | | | | |     A
      T     C T C G       C G G G G     C
      G     | | | |                 T T
      G     G A G C
        T A        A     AGGTC
                    A - T
                    C - G
                    T - A
                    C - G
                    A - T
                  C       A
                  T       A
                    T G T
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK