The detailed information of tRNA gene sequence


Sequence ID>C161050538
Genome IDCP013064
Search identical group
Phylum/ClassCandidatus Peregrinibacteria
SpeciesCandidatus Peribacter riflensis isolate RIFOXYC2_FULL_PER-ii_58_32
Start position on genome 1173058
End posion on genome 1172982
Amino Acid Asp
Anticodon GTC
Upstream region at tRNA start position
cagcagttat
tRNA gene sequence
GGGGTTGTAGCTCAGCTGGTTAGAGCGTCCGCCTGTCACGCGGAAGGTCGCGGGTTCGAG
TCCCGTCAGCCCCGCCA
Downstream region at tRNA end position
aagtccatta
Secondary structure (Cloverleaf model)
>C161050538	Asp	GTC
                   t      GCCA aagtccatta
                     G - C
                     G - C
                     G - C
                     G - C
                     T + G
                     T - A
                     G - C          T G
                    T     T G C C C     A
      C G A        A      + | | | |     G
    T       C T C G       G C G G G     C
    G       | | | |                 T T
    G       G A G C
      T T A        G     AGGTC
                    T - A
                    C - G
                    C - G
                    G - C
                    C - G
                  C       C
                  T       A
                    G T C
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK