The detailed information of tRNA gene sequence


Sequence ID>C161050544
Genome IDCP013064
Search identical group
Phylum/ClassCandidatus Peregrinibacteria
SpeciesCandidatus Peribacter riflensis isolate RIFOXYC2_FULL_PER-ii_58_32
Start position on genome 640314
End posion on genome 640238
Amino Acid Ile
Anticodon GAT
Upstream region at tRNA start position
tttacaccac
tRNA gene sequence
GGGCGATTAGCTCAGCTGGTTAGAGCGCGACACTGATAATGTCGAGGTCAGTGGTTCAAG
TCCACTATCGCCCACCA
Downstream region at tRNA end position
cttcatttcc
Secondary structure (Cloverleaf model)
>C161050544	Ile	GAT
                   c      ACCA cttcatttcc
                     G - C
                     G - C
                     G - C
                     C - G
                     G - C
                     A - T
                     T - A          T G
                    T     T C A C C     A
      C G A        A      | | | | |     A
    T       C T C G       A G T G G     C
    G       | | | |                 T T
    G       G A G C
      T T A        G     AGGTC
                    C - G
                    G - C
                    A - T
                    C - G
                    A - T
                  C       A
                  T       A
                    G A T
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK