The detailed information of tRNA gene sequence


Sequence ID>C161050545
Genome IDCP013064
Search identical group
Phylum/ClassCandidatus Peregrinibacteria
SpeciesCandidatus Peribacter riflensis isolate RIFOXYC2_FULL_PER-ii_58_32
Start position on genome 635426
End posion on genome 635350
Amino Acid Lys
Anticodon CTT
Upstream region at tRNA start position
tgcacacaaa
tRNA gene sequence
GGGTCAGTAGCTCAGTCCGGTAGAGCAGTTGCCTCTTAAGCAATTGGCCGTGGGTTCAAA
TCCCACCTGACCCACCA
Downstream region at tRNA end position
tcctccgcgc
Secondary structure (Cloverleaf model)
>C161050545	Lys	CTT
                   a      ACCA tcctccgcgc
                     G - C
                     G - C
                     G - C
                     T - A
                     C - G
                     A - T
                     G - C          T A
                    T     C A C C C     A
      T G A        A      | | | | |     A
    C       C T C G       G T G G G     C
    C       | | | |                 T T
    G       G A G C
      G T A        A     TGGCC
                    G + T
                    T - A
                    T - A
                    G - C
                    C - G
                  C       A
                  T       A
                    C T T
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK