The detailed information of tRNA gene sequence


Sequence ID>C161050553
Genome IDCP013064
Search identical group
Phylum/ClassCandidatus Peregrinibacteria
SpeciesCandidatus Peribacter riflensis isolate RIFOXYC2_FULL_PER-ii_58_32
Start position on genome 388491
End posion on genome 388404
Amino Acid Leu
Anticodon TAA
Upstream region at tRNA start position
ttcgctcttt
tRNA gene sequence
GCCGCTGTGGTGAAATGGTAGACACGGGGGACTTAAAATCCCCTGCCCGTTACAGGGCAT
GCTGGTTCGATTCCAGCCGGCGGCACCA
Downstream region at tRNA end position
ttcgactcgc
Secondary structure (Cloverleaf model)
>C161050553	Leu	TAA
                   t      ACCA ttcgactcgc
                     G - C
                     C - G
                     C - G
                     G - C
                     C - G
                     T + G
                     G - C          T T
                    T     C G A C C     A
      T A A        G      | | | | |     G
    G       A G T G       G C T G G     C
    G         | | |                 T T
    T       A C A C
      A G          G     TGCCCGTTACAGGGCAT
                    G - C
                    G - C
                    G - C
                    G - C
                    A - T
                  C       A
                  T       A
                    T A A
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK