The detailed information of tRNA gene sequence


Sequence ID>C161050555
Genome IDCP013064
Search identical group
Phylum/ClassCandidatus Peregrinibacteria
SpeciesCandidatus Peribacter riflensis isolate RIFOXYC2_FULL_PER-ii_58_32
Start position on genome 315045
End posion on genome 314969
Amino Acid His
Anticodon GTG
Upstream region at tRNA start position
cactatcgtg
tRNA gene sequence
GCGGGCGTAGCTCAGTTGGTTAGAGCGCCAGGTTGTGGCCCTGGAGGTCGTGGGTTCGAT
ACCCATCGCTCGCCCCA
Downstream region at tRNA end position
ctcttgaagt
Secondary structure (Cloverleaf model)
>C161050555	His	GTG
                   g      CCCA ctcttgaagt
                     G - C
                     C - G
                     G - C
                     G + T
                     G - C
                     C - G
                     G - C          A T
                    T     T A C C C     A
      T G A        A      + | | | |     G
    T       C T C G       G T G G G     C
    G       | | | |                 T T
    G       G A G C
      T T A        G     AGGTC
                    C - G
                    C - G
                    A - T
                    G - C
                    G - C
                  T       C
                  T       G
                    G T G
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK