The detailed information of tRNA gene sequence


Sequence ID>C161050560
Genome IDCP013065
Search identical group
Phylum/ClassCandidatus Peregrinibacteria
SpeciesCandidatus Peribacter riflensis isolate RIFOXYD1_FULL_PER-ii_59_16
Start position on genome 155444
End posion on genome 155520
Amino Acid Arg
Anticodon TCG
Upstream region at tRNA start position
ttttcacgct
tRNA gene sequence
GCCCGCGTAGCTCAGCTGGATAGAGCGCCTGGCTTCGAACCAGGAGGTCGTGGGTTCAAC
TCCTGCCGCGGGCACCA
Downstream region at tRNA end position
ttcgattcgc
Secondary structure (Cloverleaf model)
>C161050560	Arg	TCG
                   t      ACCA ttcgattcgc
                     G - C
                     C - G
                     C - G
                     C - G
                     G - C
                     C - G
                     G - C          T C
                    T     C G T C C     A
      C G A        A      | + + | |     A
    T       C T C G       G T G G G     C
    G       | | | |                 T T
    G       G A G C
      A T A        G     AGGTC
                    C - G
                    C - G
                    T - A
                    G - C
                    G - C
                  C       A
                  T       A
                    T C G
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK