The detailed information of tRNA gene sequence


Sequence ID>C161050562
Genome IDCP013065
Search identical group
Phylum/ClassCandidatus Peregrinibacteria
SpeciesCandidatus Peribacter riflensis isolate RIFOXYD1_FULL_PER-ii_59_16
Start position on genome 212825
End posion on genome 212900
Amino Acid Ala
Anticodon GGC
Upstream region at tRNA start position
attcaccttt
tRNA gene sequence
GGGGCTGTAGCTCATCTGGTAGAGCGCTTCCATGGCATGGAAGAGGTAAGGGGTTCGAGT
CCCCTCAGCTCCACCA
Downstream region at tRNA end position
ttcgactcgt
Secondary structure (Cloverleaf model)
>C161050562	Ala	GGC
                   t      ACCA ttcgactcgt
                     G - C
                     G - C
                     G + T
                     G - C
                     C - G
                     T - A
                     G - C          T G
                    T     T C C C C     A
      C T A        A      | | | | |     G
    T       C T C G       A G G G G     C
    G       | | | |                 T T
    G       G A G C
      T A          G     AGGTA
                    C - G
                    T - A
                    T - A
                    C - G
                    C - G
                  A       T
                  T       A
                    G G C
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK