The detailed information of tRNA gene sequence


Sequence ID>C161050568
Genome IDCP013065
Search identical group
Phylum/ClassCandidatus Peregrinibacteria
SpeciesCandidatus Peribacter riflensis isolate RIFOXYD1_FULL_PER-ii_59_16
Start position on genome 548037
End posion on genome 548128
Amino Acid Ser
Anticodon GCT
Upstream region at tRNA start position
ttgccggcgt
tRNA gene sequence
GGAGAGGTGGCTGAGCGGCCGAAAGCACCACACTGCTAATGTGGTATACGGGTAAAACCG
TATCGAGGGTTCGAATCCCTCCCTCTCCGCCA
Downstream region at tRNA end position
cgtcgttcgc
Secondary structure (Cloverleaf model)
>C161050568	Ser	GCT
                   t      GCCA cgtcgttcgc
                     G - C
                     G - C
                     A - T
                     G - C
                     A - T
                     G - C
                     G - C          T A
                    T     C T C C C     A
      C G A        G      | | | | |     G
    G       G T C G       G A G G G     C
    G         | | |                 T T
    C       A A G C
      C G A        A     TATACGGGTAAAACCGTATC
                    C - G
                    C - G
                    A - T
                    C - G
                    A - T
                  C       A
                  T       A
                    G C T
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK