The detailed information of tRNA gene sequence


Sequence ID>C161050572
Genome IDCP013065
Search identical group
Phylum/ClassCandidatus Peregrinibacteria
SpeciesCandidatus Peribacter riflensis isolate RIFOXYD1_FULL_PER-ii_59_16
Start position on genome 676930
End posion on genome 677005
Amino Acid Lys
Anticodon TTT
Upstream region at tRNA start position
tgtggattat
tRNA gene sequence
GGGTCAGTAGCTCAGTTGGTAGAGCAGTGCCCTTTTAAGGCATTGGTCGTGGGTTCGAAT
CCCACCTGACCCACCA
Downstream region at tRNA end position
ttcgactcgg
Secondary structure (Cloverleaf model)
>C161050572	Lys	TTT
                   t      ACCA ttcgactcgg
                     G - C
                     G - C
                     G - C
                     T - A
                     C - G
                     A - T
                     G - C          T A
                    T     C A C C C     A
      T G A        A      | | | | |     G
    T       C T C G       G T G G G     C
    G       | | | |                 T T
    G       G A G C
      T A          A     TGGTC
                    G + T
                    T - A
                    G - C
                    C - G
                    C - G
                  C       A
                  T       A
                    T T T
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK