The detailed information of tRNA gene sequence


Sequence ID>C161050605
Genome IDCP013066
Search identical group
Phylum/ClassCandidatus Peregrinibacteria
SpeciesCandidatus Peribacter riflensis isolate RIFOXYD2_FULL_PER-ii_51_23
Start position on genome 212518
End posion on genome 212595
Amino Acid Arg
Anticodon GCG
Upstream region at tRNA start position
tcattctcgt
tRNA gene sequence
GCGCCCGTAGTTCAGCCCGGATAGAACGCCAGGTTGCGGACCTGGAAGTCGTAGGTTCAA
ATCCTGCCGGGCGCACCA
Downstream region at tRNA end position
tttatccaga
Secondary structure (Cloverleaf model)
>C161050605	Arg	GCG
                   t      ACCA tttatccaga
                     G - C
                     C - G
                     G - C
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     C G T C C     A
    C C G A        A      | + | | |     A
  C         C T T G       G T A G G     C
  G         | | | |                 T T
  G         G A A C
    A T A          G     AAGTC
                    C - G
                    C - G
                    A - T
                    G - C
                    G - C
                  T       A
                  T       G
                    G C G
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK