The detailed information of tRNA gene sequence


Sequence ID>C161050610
Genome IDCP013066
Search identical group
Phylum/ClassCandidatus Peregrinibacteria
SpeciesCandidatus Peribacter riflensis isolate RIFOXYD2_FULL_PER-ii_51_23
Start position on genome 440715
End posion on genome 440792
Amino Acid Val
Anticodon TAC
Upstream region at tRNA start position
gggcgccgtt
tRNA gene sequence
GGGTGGTTAGCTCAGTTGGTTTAGAGCGTCTGGTTTACACCCAGAAGGTCACAGGTTCGA
CTCCTGTACCACCCACCA
Downstream region at tRNA end position
acctctgcga
Secondary structure (Cloverleaf model)
>C161050610	Val	TAC
                   t      ACCA acctctgcga
                     G - C
                     G - C
                     G - C
                     T - A
                     G - C
                     G - C
                     T - A          T C
                    T     T G T C C     A
    T T G A        A      | | | | |     G
  G         C T C G       A C A G G     C
  G         | | | |                 T T
  T         G A G C
    T T A          G     AGGTC
                    T - A
                    C - G
                    T - A
                    G - C
                    G - C
                  T       C
                  T       A
                    T A C
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK