The detailed information of tRNA gene sequence


Sequence ID>C161050617
Genome IDCP013066
Search identical group
Phylum/ClassCandidatus Peregrinibacteria
SpeciesCandidatus Peribacter riflensis isolate RIFOXYD2_FULL_PER-ii_51_23
Start position on genome 693438
End posion on genome 693512
Amino Acid Gly
Anticodon TCC
Upstream region at tRNA start position
tcgcaacaac
tRNA gene sequence
GCGGGCGTCGTATAATGGCTATTACCCCAGGTTTCCAACCTGGTGACGGCGGTTCGATTC
CGCTCGCCCGCTCCA
Downstream region at tRNA end position
tccgtcttcg
Secondary structure (Cloverleaf model)
>C161050617	Gly	TCC
                   c      TCCA tccgtcttcg
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     C - G
                     G - C          T T
                    T     T C G C C     A
      T A A        C      + | | | |     G
    G       T A T G       G G C G G     C
    G         | | |                 T T
    C       T T A C
      T A          C     TGAC
                    C - G
                    C - G
                    A - T
                    G - C
                    G - C
                  T       A
                  T       A
                    T C C
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK