The detailed information of tRNA gene sequence


Sequence ID>C161050622
Genome IDCP013066
Search identical group
Phylum/ClassCandidatus Peregrinibacteria
SpeciesCandidatus Peribacter riflensis isolate RIFOXYD2_FULL_PER-ii_51_23
Start position on genome 973052
End posion on genome 973141
Amino Acid Ser
Anticodon GGA
Upstream region at tRNA start position
tggccactgt
tRNA gene sequence
GGAGAGGTCGCATAGTGGCCTAGTGCGCGCGCTTGGAAAGCGCGTAGACCTGAAAGGGTC
TCGGGGGTTCGAATCCCCCCCTCTCCGCCA
Downstream region at tRNA end position
gccttcgctc
Secondary structure (Cloverleaf model)
>C161050622	Ser	GGA
                   t      GCCA gccttcgctc
                     G - C
                     G - C
                     A - T
                     G - C
                     A - T
                     G - C
                     G - C          T A
                    T     C C C C C     A
      T G A        C      | | | | |     G
    G       T A C G       G G G G G     C
    G       + | | |                 T T
    C       G T G C
      C T A        G     TAGACCTGAAAGGGTCTC
                    C - G
                    G - C
                    C - G
                    G - C
                    C - G
                  T       A
                  T       A
                    G G A
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK