The detailed information of tRNA gene sequence


Sequence ID>C161050627
Genome IDCP013066
Search identical group
Phylum/ClassCandidatus Peregrinibacteria
SpeciesCandidatus Peribacter riflensis isolate RIFOXYD2_FULL_PER-ii_51_23
Start position on genome 1150909
End posion on genome 1150834
Amino Acid Trp
Anticodon CCA
Upstream region at tRNA start position
tttctctcct
tRNA gene sequence
AGGCGCGTAGCTCAGCTGGTAGAGCACAGGTCTCCAAAACCTGGGGTCGTAGGTTCGAGC
CCTACCGCGCCTGCCA
Downstream region at tRNA end position
gatctcaaac
Secondary structure (Cloverleaf model)
>C161050627	Trp	CCA
                   t      GCCA gatctcaaac
                     A - T
                     G - C
                     G - C
                     C - G
                     G - C
                     C - G
                     G - C          C G
                    T     C A T C C     A
      C G A        A      | | | | |     G
    T       C T C G       G T A G G     C
    G       | | | |                 T T
    G       G A G C
      T A          A     GGGTC
                    C - G
                    A - T
                    G - C
                    G - C
                    T - A
                  C       A
                  T       A
                    C C A
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK