| Sequence ID | >C161050631 |
| Genome ID | CP013066 |
| Phylum/Class | Unclassified |
| Species | Candidatus Peribacter riflensis [CP013066] |
| Start position on genome | 674923 |
| End posion on genome | 674850 |
| Amino Acid | Gly |
| Anticodon | CCC |
| Upstream region at tRNA start position |
tgtgttcaaa |
| tRNA gene sequence |
GCGGGATTAGTACAGTGGTAGTATGCAAGCTTCCCAAGCTTGAGACGCGAGTTCGATTCT |
| Downstream region at tRNA end position |
cgtagtacac |
| Secondary structure (Cloverleaf model) | >C161050631 Gly CCC
a TCCA cgtagtacac
G - C
C - G
G - C
G - C
G - C
A - T
T - A T T
T T G C T C A
G A A + | | | | G
T C A T G G C G A G C
G | | | + T T
G G T A T
T A G AGAC
C - G
A - T
A - T
G - C
C - G
T A
T A
C C C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | - |
| Comment | |
| --- | |
| Input Comment |