The detailed information of tRNA gene sequence


Sequence ID>C161050631
Genome IDCP013066
Search identical group
Phylum/ClassCandidatus Peregrinibacteria
SpeciesCandidatus Peribacter riflensis isolate RIFOXYD2_FULL_PER-ii_51_23
Start position on genome 674923
End posion on genome 674850
Amino Acid Gly
Anticodon CCC
Upstream region at tRNA start position
tgtgttcaaa
tRNA gene sequence
GCGGGATTAGTACAGTGGTAGTATGCAAGCTTCCCAAGCTTGAGACGCGAGTTCGATTCT
CGTATCCCGCTCCA
Downstream region at tRNA end position
cgtagtacac
Secondary structure (Cloverleaf model)
>C161050631	Gly	CCC
                   a      TCCA cgtagtacac
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     A - T
                     T - A          T T
                    T     T G C T C     A
        G A        A      + | | | |     G
      T     C A T G       G C G A G     C
      G     | | | +                 T T
      G     G T A T
        T A        G     AGAC
                    C - G
                    A - T
                    A - T
                    G - C
                    C - G
                  T       A
                  T       A
                    C C C
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK