The detailed information of tRNA gene sequence


Sequence ID>C161050637
Genome IDCP013066
Search identical group
Phylum/ClassCandidatus Peregrinibacteria
SpeciesCandidatus Peribacter riflensis isolate RIFOXYD2_FULL_PER-ii_51_23
Start position on genome 554631
End posion on genome 554542
Amino Acid Ser
Anticodon TGA
Upstream region at tRNA start position
attccgttac
tRNA gene sequence
GGAAGCGTGCCAGAGTGGTCGATCGGGCCTGTCTTGAAAACAGGTAGACCCGCAAGGGTC
TCGGAGGTTCGAATCCTCCCGCTTCCGCCA
Downstream region at tRNA end position
tccggcttcg
Secondary structure (Cloverleaf model)
>C161050637	Ser	TGA
                   c      GCCA tccggcttcg
                     G - C
                     G - C
                     A - T
                     A - T
                     G - C
                     C - G
                     G - C          T A
                    T     C C T C C     A
      T G A        G      | | | | |     G
    G       G A C C       G G A G G     C
    G       +   | |                 T T
    T       T C G G
      C G A        G     TAGACCCGCAAGGGTCTC
                    C - G
                    C - G
                    T - A
                    G - C
                    T - A
                  C       A
                  T       A
                    T G A
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK