The detailed information of tRNA gene sequence


Sequence ID>C161050640
Genome IDCP013066
Search identical group
Phylum/ClassCandidatus Peregrinibacteria
SpeciesCandidatus Peribacter riflensis isolate RIFOXYD2_FULL_PER-ii_51_23
Start position on genome 414729
End posion on genome 414654
Amino Acid Pro
Anticodon CGG
Upstream region at tRNA start position
tggcacgcat
tRNA gene sequence
CGGGGCGTAGCTCAGTTGGTAGAGCGCACGGTTCGGGACCGTGAGGCCGAAGGTTCGAGT
CCTTTCGCCCCGACCA
Downstream region at tRNA end position
aggcaaatgg
Secondary structure (Cloverleaf model)
>C161050640	Pro	CGG
                   t      ACCA aggcaaatgg
                     C - G
                     G - C
                     G - C
                     G - C
                     G - C
                     C - G
                     G - C          T G
                    T     T T T C C     A
      T G A        A      + | | | |     G
    T       C T C G       G A A G G     C
    G       | | | |                 T T
    G       G A G C
      T A          G     AGGCC
                    C - G
                    A - T
                    C - G
                    G - C
                    G - C
                  T       A
                  T       G
                    C G G
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK