The detailed information of tRNA gene sequence


Sequence ID>C161050645
Genome IDCP013066
Search identical group
Phylum/ClassCandidatus Peregrinibacteria
SpeciesCandidatus Peribacter riflensis isolate RIFOXYD2_FULL_PER-ii_51_23
Start position on genome 116472
End posion on genome 116398
Amino Acid Asn
Anticodon GTT
Upstream region at tRNA start position
ccatcaacgt
tRNA gene sequence
TCCCCTGTAGCTCAATGGTAGAGCAGGGCGCTGTTAACGCCAAGGTTGCTGGTTCGAGTC
CAGCCGGGGGAGCCA
Downstream region at tRNA end position
tctctaacaa
Secondary structure (Cloverleaf model)
>C161050645	Asn	GTT
                   t      GCCA tctctaacaa
                     T - A
                     C - G
                     C - G
                     C - G
                     C - G
                     T + G
                     G - C          T G
                    T     C G A C C     A
        A A        A      | | | | |     G
      T     C T C G       G C T G G     C
      G     | | | |                 T T
      G     G A G C
        T A        A     AGGTT
                    G   A
                    G - C
                    G - C
                    C - G
                    G - C
                  C       A
                  T       A
                    G T T
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK