The detailed information of tRNA gene sequence


Sequence ID>C161077124
Genome IDCP014771
Search identical group
Phylum/ClassBacteroidetes
SpeciesHymenobacter sp. PAMC 26554
Start position on genome 2899384
End posion on genome 2899312
Amino Acid Arg
Anticodon CCT
Upstream region at tRNA start position
tttggggctt
tRNA gene sequence
GGCTGCGTAGTTCAAGGGATAGAATAGGCGTTTCCTAAACGCTTGATAGCAGTTCGAATC
TGCTCGTGGCTACat
Downstream region at tRNA end position
atataactaa
Secondary structure (Cloverleaf model)
>C161077124	Arg	CCT
                   t      ACat atataactaa
                     G + T
                     G - C
                     C - G
                     T + G
                     G + T
                     C - G
                     G - C          T A
                    T     T C G T C     A
      G A A        A      | | | | |     G
    G       C T T G       A G C A G     C
    G       | | | +                 T T
    A       G A A T
      T A          A     TGAT
                    G + T
                    G - C
                    C - G
                    G - C
                    T - A
                  T       A
                  T       A
                    C C T
Intron
Comment/Decision
Genome/Seq. Info.[Ensembl]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK