The detailed information of tRNA gene sequence


Sequence ID>C163000712
Genome IDCP013066
Search identical group
Phylum/ClassCandidatus Peregrinibacteria
SpeciesCandidatus Peribacter riflensis isolate RIFOXYD2_FULL_PER-ii_51_23
Start position on genome 772998
End posion on genome 772924
Amino Acid Cys
Anticodon GCA
Upstream region at tRNA start position
gttgctgcct
tRNA gene sequence
GGTGCCGTAGCCAAGTAGTAAGGCAGGGGTCTGCAAAACCCCCATACGCGAGTGCAATTC
TCGCCGGCACCTCCA
Downstream region at tRNA end position
gcctacgcaa
Secondary structure (Cloverleaf model)
>C163000712	Cys	GCA
                   t      TCCA gcctacgcaa
                     G - C
                     G - C
                     T - A
                     G - C
                     C - G
                     C - G
                     G - C          T T
                    T     C G C T C     A
        G A        A      | | | | |     A
      T     A C C G       G C G A G     C
      A       | | |                 T G
      G     A G G C
        T A        A     CATAC
                    G - C
                    G - C
                    G - C
                    G - C
                    T - A
                  C       A
                  T       A
                    G C A
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK