The detailed information of tRNA gene sequence


Sequence ID>C163000713
Genome IDCP013066
Search identical group
Phylum/ClassCandidatus Peregrinibacteria
SpeciesCandidatus Peribacter riflensis isolate RIFOXYD2_FULL_PER-ii_51_23
Start position on genome 423430
End posion on genome 423355
Amino Acid Ala
Anticodon CGC
Upstream region at tRNA start position
cgtctggtac
tRNA gene sequence
GGGGCTGTAGCTCAGCTGATAGAGCGCCGCATTCGCATTGCGGAGGTCAGGGGTTTGATT
CCCCTCAGCTCCACCA
Downstream region at tRNA end position
ttccaatccc
Secondary structure (Cloverleaf model)
>C163000713	Ala	CGC
                   c      ACCA ttccaatccc
                     G - C
                     G - C
                     G + T
                     G - C
                     C - G
                     T - A
                     G - C          T T
                    T     T C C C C     A
      C G A        A      | | | | |     G
    T       C T C G       A G G G G     T
    G       | | | |                 T T
    A       G A G C
      T A          G     AGGTC
                    C - G
                    C - G
                    G - C
                    C - G
                    A - T
                  T       T
                  T       A
                    C G C
Intron
Comment/Decision
Genome/Seq. Info.-

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK