| Sequence ID | >W1610004210 |
| Genome ID | AGIW01000001 |
| Phylum/Class | Thermoproteota |
| Species | Desulfurococcus amylolyticus DSM 16532 [AGIW] |
| Start position on genome | 1106201 |
| End posion on genome | 1106275 |
| Amino Acid | Lys |
| Anticodon | TTT |
| Upstream region at tRNA start position |
gaaaatagtt |
| tRNA gene sequence |
GGGCCCGTAGCTCAGCTTGGTAGAGCGGCGGGCTTTTAACCCGTAGGTCCCGGGTTCAAA |
| Downstream region at tRNA end position |
tacccgcctt |
| Secondary structure (Cloverleaf model) | >W1610004210 Lys TTT
t GCat tacccgcctt
G - C
G - C
G - C
C - G
C - G
C - G
G - C T A
T G G C C C A
C G A A | | | | | A
T C T C G C C G G G C
T | | | | T T
G G A G C
G T A G AGGTC
G + T
C - G
G - C
G - C
G - C
C A
T A
T T T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |