The detailed information of tRNA gene sequence


Sequence ID>W1610026713
Genome IDAVBG01000021
Search identical group
Phylum/ClassFirmicutes
SpeciesPontibacillus chungwhensis BH030062 (AVBG)
Start position on genome 42406
End posion on genome 42334
Amino Acid Ala
Anticodon GGC
Upstream region at tRNA start position
cattccatac
tRNA gene sequence
GGGGCATTAGCTCAGCTGGGAGAGCGCTACACTGGCAGTGTAGAGGTCAGCGGTTCGAGC
CCGCTATGCTCCAtcg
Downstream region at tRNA end position
agaaagcctt
Secondary structure (Cloverleaf model)
>W1610026713	Ala	GGC
                   c      Atcg agaaagcctt
                     G - C
                     G - C
                     G + T
                     G - C
                     C - G
                     A - T
                     T - A          C G
                    T     T C G C C     A
      C G A        A      | | | | |     G
    T       C T C G       A G C G G     C
    G       | | | |                 T T
    G       G A G C
      G A          G     AGGTC
                    C - G
                    T - A
                    A - T
                    C - G
                    A - T
                  C       G
                  T       A
                    G G C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK