The detailed information of tRNA gene sequence


Sequence ID>W1610039902
Genome IDAZSZ01000039
Search identical group
Phylum/ClassFirmicutes
SpeciesBacillus licheniformis LMG 6934 (AZSZ)
Start position on genome 20338
End posion on genome 20266
Amino Acid Ala
Anticodon GGC
Upstream region at tRNA start position
ttaaatatac
tRNA gene sequence
GGGGCATTAGCTCAGCTGGGAGAGCGCTACACTGGCAGTGTAGAGGTCAGCGGTTCGAGC
CCGCTATGCTCCAtct
Downstream region at tRNA end position
ttaaaaccct
Secondary structure (Cloverleaf model)
>W1610039902	Ala	GGC
                   c      Atct ttaaaaccct
                     G - C
                     G - C
                     G + T
                     G - C
                     C - G
                     A - T
                     T - A          C G
                    T     T C G C C     A
      C G A        A      | | | | |     G
    T       C T C G       A G C G G     C
    G       | | | |                 T T
    G       G A G C
      G A          G     AGGTC
                    C - G
                    T - A
                    A - T
                    C - G
                    A - T
                  C       G
                  T       A
                    G G C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK