The detailed information of tRNA gene sequence


Sequence ID>W1610042277
Genome IDBAXQ01000008
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesThalassobacillus sp. C254 (BAXQ)
Start position on genome 102443
End posion on genome 102518
Amino Acid Ala
Anticodon GGC
Upstream region at tRNA start position
aataggaaat
tRNA gene sequence
GGGGCATTAGCTCAGCTGGGAGAGCGCTACACTGGCAGTGTAGAGGTCAGCGGTTCGAGC
CCGCTATGCTCCACCA
Downstream region at tRNA end position
tacataatca
Secondary structure (Cloverleaf model)
>W1610042277	Ala	GGC
                   t      ACCA tacataatca
                     G - C
                     G - C
                     G + T
                     G - C
                     C - G
                     A - T
                     T - A          C G
                    T     T C G C C     A
      C G A        A      | | | | |     G
    T       C T C G       A G C G G     C
    G       | | | |                 T T
    G       G A G C
      G A          G     AGGTC
                    C - G
                    T - A
                    A - T
                    C - G
                    A - T
                  C       G
                  T       A
                    G G C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK