| Sequence ID | >W1610045279 |
| Genome ID | BBBJ01000004 |
| Phylum/Class | Thermoproteota |
| Species | Vulcanisaeta distributa JCM 11217 [BBBJ] |
| Start position on genome | 136194 |
| End posion on genome | 136118 |
| Amino Acid | Ala |
| Anticodon | CGC |
| Upstream region at tRNA start position |
gctttccctt |
| tRNA gene sequence |
GGGCCGGTAGTCTAGCCTGGAAGGATGCCCGCCTCGCACGCGGGAGATCCCGGGTTCAAA |
| Downstream region at tRNA end position |
caatcaatcc |
| Secondary structure (Cloverleaf model) | >W1610045279 Ala CGC
t ACCA caatcaatcc
G - C
G - C
G + T
C - G
C - G
G - C
G - C T A
T G G C C C A
C G A A | | | | | A
C T C T G C C G G G C
T + | | + T T
G G G A T
G A A G AGATC
C - G
C - G
C - G
G - C
C - G
C C
T A
C G C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |