The detailed information of tRNA gene sequence


Sequence ID>W1610049858
Genome IDBBFH01001821
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesParacoccus denitrificans JCM 21484 (BBFH)
Start position on genome 157
End posion on genome 84
Amino Acid Gly
Anticodon CCC
Upstream region at tRNA start position
tccgggcctc
tRNA gene sequence
GCGGGTGTAGCTCAATGGTAGAGCCGCAGCTTCCCAAGCTGAAGACGAGGGTTCGATTCC
CTTCACCCGCTCCA
Downstream region at tRNA end position
gcctttcccg
Secondary structure (Cloverleaf model)
>W1610049858	Gly	CCC
                   c      TCCA gcctttcccg
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     T - A
                     G - C          T T
                    T     T T C C C     A
        A A        A      + | | | |     G
      T     C T C G       G A G G G     C
      G     | | | |                 T T
      G     G A G C
        T A        C     AGAC
                    G   A
                    C - G
                    A - T
                    G - C
                    C - G
                  T       A
                  T       A
                    C C C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK