The detailed information of tRNA gene sequence


Sequence ID>W1610053018
Genome IDBBNZ01000001
Search identical group
Phylum/ClassGammaproteobacteria
SpeciesPlautia stali symbiont (BBNZ)
Start position on genome 7499
End posion on genome 7425
Amino Acid Arg
Anticodon CCT
Upstream region at tRNA start position
cgcgccgcac
tRNA gene sequence
GTCTCCTTAGTTAAATGGATATAACGAGCCCCTCCTAAGGGCTAGTTGCAGGTTCGATTC
CTGCAGGGGACACCA
Downstream region at tRNA end position
gtaacacctc
Secondary structure (Cloverleaf model)
>W1610053018	Arg	CCT
                   c      ACCA gtaacacctc
                     G - C
                     T - A
                     C - G
                     T + G
                     C - G
                     C - G
                     T - A          T T
                    T     C G T C C     A
      T A A        A      | | | | |     G
    G       A T T G       G C A G G     C
    G       | | | |                 T T
    A       T A A C
      T A          G     AGTT
                    A - T
                    G - C
                    C - G
                    C - G
                    C - G
                  C       A
                  T       A
                    C C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK