The detailed information of tRNA gene sequence


Sequence ID>W1610072729
Genome IDBCVF01000053
Search identical group
Phylum/ClassFirmicutes
SpeciesBacillus badius NBRC 15713 (BCVF)
Start position on genome 5991
End posion on genome 6063
Amino Acid Ala
Anticodon GGC
Upstream region at tRNA start position
agcaatgaac
tRNA gene sequence
GGGGCATTAGCTCAGCTGGGAGAGCGCTACACTGGCAGTGTAGAGGTCAGCGGTTCGAGC
CCGCTATGCTCCAtta
Downstream region at tRNA end position
cttaaaccct
Secondary structure (Cloverleaf model)
>W1610072729	Ala	GGC
                   c      Atta cttaaaccct
                     G - C
                     G - C
                     G + T
                     G - C
                     C - G
                     A - T
                     T - A          C G
                    T     T C G C C     A
      C G A        A      | | | | |     G
    T       C T C G       A G C G G     C
    G       | | | |                 T T
    G       G A G C
      G A          G     AGGTC
                    C - G
                    T - A
                    A - T
                    C - G
                    A - T
                  C       G
                  T       A
                    G G C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK