The detailed information of tRNA gene sequence


Sequence ID>W1610076749
Genome IDBCYZ01000041
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesSphingomonas pruni NBRC 15498 (BCYZ)
Start position on genome 4269
End posion on genome 4345
Amino Acid Arg
Anticodon CCT
Upstream region at tRNA start position
gaccgagcgt
tRNA gene sequence
GGTTCCGTAGCTCAGCTGGACAGAGCGCCACTTTCCTAAAGTGGGCGTCGGGGGTTCGAG
TCCCTCCGGGACCACCA
Downstream region at tRNA end position
cctcaccatc
Secondary structure (Cloverleaf model)
>W1610076749	Arg	CCT
                   t      ACCA cctcaccatc
                     G - C
                     G - C
                     T - A
                     T + G
                     C - G
                     C - G
                     G - C          T G
                    T     C T C C C     A
      C G A        A      | + | | |     G
    T       C T C G       G G G G G     C
    G       | | | |                 T T
    G       G A G C
      A C A        G     GCGTC
                    C - G
                    C - G
                    A - T
                    C - G
                    T - A
                  T       A
                  T       A
                    C C T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK