The detailed information of tRNA gene sequence


Sequence ID>W1610077011
Genome IDBCZE01000068
Search identical group
Phylum/ClassAlphaproteobacteria
SpeciesNovosphingobium rosa NBRC 15208 (BCZE)
Start position on genome 28317
End posion on genome 28393
Amino Acid Met
Anticodon CAT
Upstream region at tRNA start position
ggcaacgtgt
tRNA gene sequence
GGCGGAGTAGCTCAGTCGGTTAGAGCAGCGGAATCATAATCCGCGTGTCGGGGGTTCGAG
TCCCTCCTCCGCTACCA
Downstream region at tRNA end position
ctaatacagt
Secondary structure (Cloverleaf model)
>W1610077011	Met	CAT
                   t      ACCA ctaatacagt
                     G + T
                     G - C
                     C - G
                     G - C
                     G - C
                     A - T
                     G - C          T G
                    T     C T C C C     A
      T G A        A      | + | | |     G
    C       C T C G       G G G G G     C
    G       | | | |                 T T
    G       G A G C
      T T A        A     GTGTC
                    G - C
                    C - G
                    G - C
                    G - C
                    A - T
                  A       A
                  T       A
                    C A T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK