The detailed information of tRNA gene sequence


Sequence ID>C131003906
Genome IDCP003495
Search identical group
Phylum/ClassCyanobacteria
SpeciesCyanobium gracile PCC 6307
Start position on genome 1771772
End posion on genome 1771862
Amino Acid Ser
Anticodon GCT
Upstream region at tRNA start position
ctgggctacT
tRNA gene sequence
GGAGAGGTGGCTGAGTGGTTGAAAGCGGCTCCCTGCTAAGGAGTTACAGGAGGCAACTTC
TGTCGAGGGTTCGAATCCCTCCCTCTCCGTtc
Downstream region at tRNA end position
caggccctgc
Secondary structure (Cloverleaf model)
>C131003906	Ser	GCT
                   T      GTtc caggccctgc
                     G - C
                     G - C
                     A - T
                     G - C
                     A - T
                     G - C
                     G - C          T A
                    T     C T C C C     A
      T G A        G      | | | | |     G
    G       G T C G       G A G G G     C
    G         | | |                 T T
    T       A A G C
      T G A        G     TACAGGAGGCAACTTCTGTC
                    G + T
                    C - G
                    T - A
                    C - G
                    C - G
                  C       A
                  T       A
                    G C T
Intron
Comment/Decision
Genome/Seq. Info.[Ensembl]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK