The detailed information of tRNA gene sequence


Sequence ID>C131003931
Genome IDCP003495
Search identical group
Phylum/ClassCyanobacteria
SpeciesCyanobium gracile PCC 6307
Start position on genome 1477718
End posion on genome 1477637
Amino Acid Leu
Anticodon GAG
Upstream region at tRNA start position
ctccgaccac
tRNA gene sequence
GCGGATGTGGTGGAATTGGTAGACACGCACGTTTGAGGGGCGTGTGGCTTCGGCCTTGCG
AGTTCAAGTCTCGCCATCCGCAttt
Downstream region at tRNA end position
ctcttttccc
Secondary structure (Cloverleaf model)
>C131003931	Leu	GAG
                   c      Attt ctcttttccc
                     G - C
                     C - G
                     G - C
                     G - C
                     A - T
                     T - A
                     G - C          T G
                    T     C G C T C     A
      T A A        G      | | | | |     A
    T       G G T G       G C G A G     C
    G         | | |                 T T
    G       A C A C
      T A G        G     TGGCTTCGGCCTT
                    C - G
                    A - T
                    C - G
                    G - C
                    T + G
                  T       G
                  T       G
                    G A G
Intron
Comment/Decision
Genome/Seq. Info.[Ensembl]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK